pSpCas9(BB)-2A-Blast_HP1beta_gRNA
(Plasmid
#127908)
-
PurposeWT Cas9 Vector with Blasticidin Selection Marker targeting the 5' end of the human HP1beta gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127908 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Blast
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA for Human 5' HP1beta
-
gRNA/shRNA sequenceggtgctagaagaggaggaag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site Bbsi (destroyed during cloning)
- 5′ sequencing primer cacctctgacttgagcgtcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byhttps://www.addgene.org/42230/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-Blast_HP1beta_gRNA was a gift from Mark Groudine (Addgene plasmid # 127908 ; http://n2t.net/addgene:127908 ; RRID:Addgene_127908)