pSUMO-LIC-CHIKV-nsP2h
(Plasmid
#127935)
-
PurposeExpresses CHIKV nsP2h (1-465 aa) in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 10000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCHIKV nsP2h
-
SpeciesChikungunya virus
-
Insert Size (bp)1731
-
GenBank IDKC149887.1
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His6-Sumo-TEV (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer 5' TAATACGACTCACTATAGGG 3'
- 3′ sequencing primer 5' GCTAGTTATTGCTCAGCGG 3'
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUMO-LIC-CHIKV-nsP2h was a gift from Dahai Luo (Addgene plasmid # 127935 ; http://n2t.net/addgene:127935 ; RRID:Addgene_127935) -
For your References section:
Structural insights into RNA recognition by the Chikungunya virus nsP2 helicase. Law YS, Utt A, Tan YB, Zheng J, Wang S, Chen MW, Griffin PR, Merits A, Luo D. Proc Natl Acad Sci U S A. 2019 May 7;116(19):9558-9567. doi: 10.1073/pnas.1900656116. Epub 2019 Apr 18. 10.1073/pnas.1900656116 PubMed 31000599