Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSUMO-LIC-CHIKV-nsP2h
(Plasmid #127935)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127935 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Currently unavailable outside the U.S.

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 10000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CHIKV nsP2h
  • Species
    Chikungunya virus
  • Insert Size (bp)
    1731
  • GenBank ID
    KC149887.1
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His6-Sumo-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer 5' TAATACGACTCACTATAGGG 3'
  • 3′ sequencing primer 5' GCTAGTTATTGCTCAGCGG 3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSUMO-LIC-CHIKV-nsP2h was a gift from Dahai Luo (Addgene plasmid # 127935 ; http://n2t.net/addgene:127935 ; RRID:Addgene_127935)
  • For your References section:

    Structural insights into RNA recognition by the Chikungunya virus nsP2 helicase. Law YS, Utt A, Tan YB, Zheng J, Wang S, Chen MW, Griffin PR, Merits A, Luo D. Proc Natl Acad Sci U S A. 2019 May 7;116(19):9558-9567. doi: 10.1073/pnas.1900656116. Epub 2019 Apr 18. 10.1073/pnas.1900656116 PubMed 31000599