Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #127952)


Item Catalog # Description Quantity Price (USD)
Plasmid 127952 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter CAG
  • Tags / Fusion Proteins
    • His6 (N terminal on insert)
    • Xpress epitope (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Commercial use is protected by US Patent 9939437

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-iGlucoSnFR-TS was a gift from Gary Yellen (Addgene plasmid # 127952 ; ; RRID:Addgene_127952)
  • For your References section:

    Quantitative in vivo imaging of neuronal glucose concentrations with a genetically encoded fluorescence lifetime sensor. Diaz-Garcia CM, Lahmann C, Martinez-Francois JR, Li B, Koveal D, Nathwani N, Rahman M, Keller JP, Marvin JS, Looger LL, Yellen G. J Neurosci Res. 2019 May 20. doi: 10.1002/jnr.24433. 10.1002/jnr.24433 PubMed 31106909