-
PurposesgRNA expression vector compatible with CROP-Seq and imaging screens
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiGuide-Puro
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin ; BFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEF1a-Puro-T2A-2xmycNLS-WPRE-mU6-sgRNA
-
gRNA/shRNA sequencegaccaggatgggcaccaccc
- Promoter mU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site BlpI (not destroyed)
- 5′ sequencing primer CAGCACAAAAGGAAACTCACC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMK1334 was a gift from Martin Kampmann (Addgene plasmid # 127965 ; http://n2t.net/addgene:127965 ; RRID:Addgene_127965) -
For your References section:
CRISPR Interference-Based Platform for Multimodal Genetic Screens in Human iPSC-Derived Neurons. Tian R, Gachechiladze MA, Ludwig CH, Laurie MT, Hong JY, Nathaniel D, Prabhu AV, Fernandopulle MS, Patel R, Abshari M, Ward ME, Kampmann M. Neuron. 2019 Aug 5. pii: S0896-6273(19)30640-3. doi: 10.1016/j.neuron.2019.07.014. 10.1016/j.neuron.2019.07.014 PubMed 31422865