Skip to main content

pGL4.22-VEGF-HRE::dLUC
(Plasmid #128096)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128096 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 128096-D50 50 μg of DNA in Tris buffer $495
DNA 128096-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL4.22
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5570
  • Total vector size (bp) 5779
  • Modifications to backbone
    insertion of the VEGF HRE (x5) into promoter region
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The depositing lab used Top10 in their studies.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Hypoxia response element (x5) from VEGF promoter
  • Alt name
    HRE (x5), HIF response element (x5)
  • Alt name
    vascular endothelial growth factor hypoxia response element (x3)
  • Alt name
    VEGF, VEGFA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    208
  • GenBank ID
    NM_001025366
  • Entrez Gene
    VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
  • Promoter inserted VEGF hypoxia response elements (HRE) (x5)
  • Tag / Fusion Protein
    • drives expression of destabilized luciferase (2CP) for real-time HRE activity assessment (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site xhoI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer RVprimer3: CTAGCAAAATAGGCTGTCCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    5HRE/GFP (Martin Brown and Thomas Foster, Addgene plasmid #46926) and pGL4.22 (Promega)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.22-VEGF-HRE::dLUC was a gift from Chi Van Dang (Addgene plasmid # 128096 ; http://n2t.net/addgene:128096 ; RRID:Addgene_128096)
  • For your References section:

    Acid Suspends the Circadian Clock in Hypoxia through Inhibition of mTOR. Walton ZE, Patel CH, Brooks RC, Yu Y, Ibrahim-Hashim A, Riddle M, Porcu A, Jiang T, Ecker BL, Tameire F, Koumenis C, Weeraratna AT, Welsh DK, Gillies R, Alwine JC, Zhang L, Powell JD, Dang CV. Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31. 10.1016/j.cell.2018.05.009 PubMed 29861175