pGL4.22-PGK1-HRE::dLUC
(Plasmid #128095)

• Purpose: Hypoxia response element real-time luciferase reporter
• Depositing Lab: Chi Van Dang
• Publication: Walton et al Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31.

Backbone

• Vector backbone: pGL4.22
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5566
• Total vector size (bp): 5647
• Modifications to backbone: insertion of the PGK1 HRE (x3) into promoter region
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: The depositing lab used Top10 in their studies.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Hypoxia response element (x3) from PGK1 promoter
• Alt name: HRE (x3)
• Alt name: HIF response element (x3)
• Alt name: phosphoglycerate kinase 1 hypoxia response element (x3)
• Species: H. sapiens (human)
• Insert Size (bp): 79
• GenBank ID: NM_000291
• Entrez Gene: PGK1 (a.k.a. HEL-S-68p, MIG10, PGKA)
• Promoter: inserted PGK1 hypoxia response elements (HRE) (x3)
• Tag / Fusion Protein:
  • drives expression of destabilized luciferase (2CP) for real-time HRE activity assessment (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: RVprimer3: CTAGCAAAATAGGCTGTCCC

Resource Information

• Supplemental Documents:
  • pGL422PGK1HREdLUC.doc
• A portion of this plasmid was derived from a plasmid made by: HRE-pGL2-TK (Li et al., 2014; Celeste Simon Lab) and pGL4.22 (Promega)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry