pGL4.22-VEGF-HRE::dLUC
(Plasmid #128096)

• Purpose: Hypoxia response element real-time luciferase reporter
• Depositing Lab: Chi Van Dang
• Publication: Walton et al Cell. 2018 Jun 28;174(1):72-87.e32. doi: 10.1016/j.cell.2018.05.009. Epub 2018 May 31.

Backbone

• Vector backbone: pGL4.22
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5570
• Total vector size (bp): 5779
• Modifications to backbone: insertion of the VEGF HRE (x5) into promoter region
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: The depositing lab used Top10 in their studies.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Hypoxia response element (x5) from VEGF promoter
• Alt name: HRE (x5), HIF response element (x5)
• Alt name: vascular endothelial growth factor hypoxia response element (x3)
• Alt name: VEGF, VEGFA
• Species: H. sapiens (human)
• Insert Size (bp): 208
• GenBank ID: NM_001025366
• Entrez Gene: VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
• Promoter: inserted VEGF hypoxia response elements (HRE) (x5)
• Tag / Fusion Protein:
  • drives expression of destabilized luciferase (2CP) for real-time HRE activity assessment (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: xhoI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: RVprimer3: CTAGCAAAATAGGCTGTCCC

Resource Information

• Supplemental Documents:
  • cloning strategy and reconstructed sequence
  • pGL4.22-VEGF-HRE::dLUC sequenced region
• A portion of this plasmid was derived from a plasmid made by: 5HRE/GFP (Martin Brown and Thomas Foster, Addgene plasmid #46926) and pGL4.22 (Promega)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry