pKF-D2irTNP2AG-T2APuroR-5kwh
(Plasmid
#128255)
-
PurposeMammalian linearizer gene circuit based on negative feedback in a Flp-In expression system controlling the PuroR gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDN-D2irTN2aG5kwh
-
Backbone manufacturerCustom
- Backbone size w/o insert (bp) 7547
- Total vector size (bp) 8198
-
Modifications to backboneReplaced hTetR::P2A::EGFP in the backbone with the insert.
-
Vector typeMammalian Expression, Synthetic Biology ; Flp-In expression vector
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehTetR::P2A::EGFP::T2A::PuroR
-
Alt nameHumanized Tetracycline Repressor
-
Alt nameEGFP
-
Alt namePuroR
-
SpeciesSynthetic
-
Insert Size (bp)2096
- Promoter CMV-D2ir promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACGGGCCAGATATACGCGTT
- 3′ sequencing primer GCGGCCGCACCGGTTCAGGCACCGGGCTTGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe human codon-optimized TetR regulator was previously developed in pDN-D2irTNG4kwh (Addgene plasmid # 44722; Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid encodes a synthetic gene circuit controlling the PuroR gene using negative feedback through a humanized tetracycline repressor (hTetR) self-repressing a CMV-derived promoter with 2 tetO2 sites (CMV-D2ir). The circuit is also called mNF-PuroR.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKF-D2irTNP2AG-T2APuroR-5kwh was a gift from Gabor Balazsi (Addgene plasmid # 128255 ; http://n2t.net/addgene:128255 ; RRID:Addgene_128255) -
For your References section:
Role of network-mediated stochasticity in mammalian drug resistance. Farquhar KS, Charlebois DA, Szenk M, Cohen J, Nevozhay D, Balazsi G. Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w. 10.1038/s41467-019-10330-w PubMed 31235692