Skip to main content
Addgene
Open Menu

PB-SAM
(Plasmid #102559)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102559 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 102559-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 102559-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    piggybac
  • Backbone size w/o insert (bp) 3902
  • Total vector size (bp) 14443
  • Vector type
    Mammalian Expression, CRISPR ; piggybac transposon
  • Selectable markers
    Hygromycin, Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MS2-P65-HSF1_T2A_Hygro
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2523
  • Mutation
    N55K in MS2
  • Promoter EF1A

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcacttgatgtaattctc
  • 3′ sequencing primer cgtaagttatgtaacgcg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    dCAS9(D10A, N863A)-VP64_T2A_Blast
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    4875
  • Mutation
    D10A and N863A in Cas9
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctgctaaccatgttcatgcc
  • 3′ sequencing primer gcattacacgtcttgagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCAS9-VP64 and MS2-P65-HSF1 cassettes are from Feng Zhang's lab (Addgene #61423 and #61425).

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-SAM was a gift from Ying Liu (Addgene plasmid # 102559 ; http://n2t.net/addgene:102559 ; RRID:Addgene_102559)

  • For your References section:

    One-Step piggyBac Transposon-Based CRISPR/Cas9 Activation of Multiple Genes. Li S, Zhang A, Xue H, Li D, Liu Y. Mol Ther Nucleic Acids. 2017 Sep 15;8:64-76. doi: 10.1016/j.omtn.2017.06.007. Epub 2017 Jun 15. 10.1016/j.omtn.2017.06.007 PubMed 28918057
Related items:
Commonly requested with: