Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #102563)


Item Catalog # Description Quantity Price (USD)
Plasmid 102563 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 16156
  • Vector type
    Mammalian Expression, CRISPR ; piggybac transposon
  • Promoter N/A
  • Selectable markers
    Hygromycin, Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer catgcttggttcggatgccc
  • 3′ sequencing primer gcattacacgtcttgagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCAS9-VP64 and MS2-P65-HSF1 cassettes are from Feng Zhang's lab (Addgene #61423 and #61425).
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-SAM-Dest was a gift from Ying Liu (Addgene plasmid # 102563 ; ; RRID:Addgene_102563)
  • For your References section:

    One-Step piggyBac Transposon-Based CRISPR/Cas9 Activation of Multiple Genes. Li S, Zhang A, Xue H, Li D, Liu Y. Mol Ther Nucleic Acids. 2017 Sep 15;8:64-76. doi: 10.1016/j.omtn.2017.06.007. Epub 2017 Jun 15. 10.1016/j.omtn.2017.06.007 PubMed 28918057