Skip to main content

lenti sgRNA(MS2)_puro optimized backbone
(Plasmid #73797)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73797 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLKO
  • Backbone size (bp) 8162
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter U6 and EF1A
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GAG GGC CTA TTT CCC ATG ATT CCT TCA TAT
  • 3′ sequencing primer cctagaaggtccattagctgcaaagattcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti sgRNA(MS2)_puro optimized backbone was a gift from Feng Zhang (Addgene plasmid # 73797 ; http://n2t.net/addgene:73797 ; RRID:Addgene_73797)
  • For your References section:

    Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Joung J, Konermann S, Gootenberg JS, Abudayyeh OO, Platt RJ, Brigham MD, Sanjana NE, Zhang F. Nat Protoc. 2017 Apr;12(4):828-863. doi: 10.1038/nprot.2017.016. Epub 2017 Mar 23. 10.1038/nprot.2017.016 PubMed 28333914