pKF-P14MMP2AG-T2APuroR-5h
(Plasmid
#128256)
-
PurposeMammalian positive feedback gene circuit in a Flp-In expression system controlling the PuroR gene. Also called mPF-PuroR.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepKF-P14MM2AG5h
-
Backbone manufacturerCustom
- Backbone size w/o insert (bp) 6246
- Total vector size (bp) 6854
-
Modifications to backboneReplaced rtTA::P2A::EGFP with insert.
-
Vector typeMammalian Expression, Synthetic Biology ; Flp-In expression vector
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTA-Advanced::P2A::EGFP::T2A::PuroR
-
Alt namereverse tetracycline Trans Activator (rtTA)
-
Alt nameEGFP
-
Alt namePuroR
-
SpeciesSynthetic
-
Insert Size (bp)2217
- Promoter tight TRE promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATATACGCGTCGAGGCCCTTTC
- 3′ sequencing primer GCGGCCGCACCGGTTCAGGCACCGGGCTTGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid encodes a synthetic gene circuit with positive feedback from rtTA activating the tight TRE promoter to control PuroR gene expression in an Flp-In expression vector. The custom backbone is missing the PuroR gene. We used overlap extension to replace the rtTA::P2A::EGFP fragment in the backbone with the new insert. The synthetic gene circuit is also called mPF-PuroR.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKF-P14MMP2AG-T2APuroR-5h was a gift from Gabor Balazsi (Addgene plasmid # 128256 ; http://n2t.net/addgene:128256 ; RRID:Addgene_128256) -
For your References section:
Role of network-mediated stochasticity in mammalian drug resistance. Farquhar KS, Charlebois DA, Szenk M, Cohen J, Nevozhay D, Balazsi G. Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w. 10.1038/s41467-019-10330-w PubMed 31235692