-
PurposeBicistronic vector to express mitochondrial targeted mCherry-FRB (MitoTrap) as well as 1x FKBP-GBPenhancer (GFP Nanobody with 1 FKBP domain).
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmCherry-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMitoTrap
-
Alt nameMito-mCherry-FRB
-
SpeciesSynthetic
-
Insert Size (bp)1107
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TTTAGTGAACCGTCAGATC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFKBP(I)-GBPen
-
Alt nameFKBP-GBPen
-
Alt name1XFKBP Dongle
-
SpeciesSynthetic
-
Insert Size (bp)705
- Promoter IRES
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site Bgl II (not destroyed)
- 5′ sequencing primer -
- 3′ sequencing primer TTTAAAGCAAGTAAAACCTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGene synthesis
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMito-mCherry-FRB_IRES_FKBP(I)-GBPen was a gift from Stephen Royle (Addgene plasmid # 128267 ; http://n2t.net/addgene:128267 ; RRID:Addgene_128267) -
For your References section:
Unintended perturbation of protein function using GFP nanobodies in human cells. Kuey C, Larocque G, Clarke NI, Royle SJ. J Cell Sci. 2019 Nov 6;132(21). pii: jcs.234955. doi: 10.1242/jcs.234955. 10.1242/jcs.234955 PubMed 31601614