pMito-GBPen
(Plasmid
#128269)
-
PurposeExpression of mitochondrially targeted GBPen (GFP Nanobody)
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128269 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMito-GBPen
-
Alt nameDongleTrap
-
Alt nameTom70(MTS)-GBPen
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer -
- 3′ sequencing primer TTTAAAGCAAGTAAAACCTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGene synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMito-GBPen was a gift from Stephen Royle (Addgene plasmid # 128269 ; http://n2t.net/addgene:128269 ; RRID:Addgene_128269) -
For your References section:
Unintended perturbation of protein function using GFP nanobodies in human cells. Kuey C, Larocque G, Clarke NI, Royle SJ. J Cell Sci. 2019 Nov 6;132(21). pii: jcs.234955. doi: 10.1242/jcs.234955. 10.1242/jcs.234955 PubMed 31601614