pMito-GBPen
(Plasmid #128269)

• Purpose: Expression of mitochondrially targeted GBPen (GFP Nanobody)
• Depositing Lab: Stephen Royle
• Publication: Kuey et al J Cell Sci. 2019 Nov 6;132(21). pii: jcs.234955. doi: 10.1242/jcs.234955.

Backbone

• Vector backbone: pEGFP-C1
  (Search Vector Database)
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Mito-GBPen
• Alt name: DongleTrap
• Alt name: Tom70(MTS)-GBPen
• Species: Synthetic
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: -
• 3′ sequencing primer: TTTAAAGCAAGTAAAACCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Gene synthesis

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry