Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMito-mCherry-FRB_IRES_FKBP(I)-GBPen
(Plasmid #128267)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128267 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmCherry-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MitoTrap
  • Alt name
    Mito-mCherry-FRB
  • Species
    Synthetic
  • Insert Size (bp)
    1107
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TTTAGTGAACCGTCAGATC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FKBP(I)-GBPen
  • Alt name
    FKBP-GBPen
  • Alt name
    1XFKBP Dongle
  • Species
    Synthetic
  • Insert Size (bp)
    705
  • Promoter IRES

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site Bgl II (not destroyed)
  • 5′ sequencing primer -
  • 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Gene synthesis

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMito-mCherry-FRB_IRES_FKBP(I)-GBPen was a gift from Stephen Royle (Addgene plasmid # 128267 ; http://n2t.net/addgene:128267 ; RRID:Addgene_128267)
  • For your References section:

    Unintended perturbation of protein function using GFP nanobodies in human cells. Kuey C, Larocque G, Clarke NI, Royle SJ. J Cell Sci. 2019 Nov 6;132(21). pii: jcs.234955. doi: 10.1242/jcs.234955. 10.1242/jcs.234955 PubMed 31601614