pCIneoGFP-BMI1
(Plasmid
#128328)
-
PurposeMammalian expression vector of GFP-tagged human BMI1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128328 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCIneo
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5472
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBMI1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)980
-
GenBank ID648
-
Entrez GeneBMI1 (a.k.a. FLVI2/BMI1, PCGF4, RNF51, flvi-2/bmi-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ggcatggacgagctgtacaa
- 3′ sequencing primer gaacctgaaacataaaatgaat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert for BMI1 contains an S572P compared to the reference NP_001190991.1 that does not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIneoGFP-BMI1 was a gift from Yutaka Hata (Addgene plasmid # 128328 ; http://n2t.net/addgene:128328 ; RRID:Addgene_128328) -
For your References section:
The RASSF6 Tumor Suppressor Protein Regulates Apoptosis and Cell Cycle Progression via Retinoblastoma Protein. Hossain S, Iwasa H, Sarkar A, Maruyama J, Arimoto-Matsuzaki K, Hata Y. Mol Cell Biol. 2018 Aug 15;38(17). pii: MCB.00046-18. doi: 10.1128/MCB.00046-18. Print 2018 Sep 1. 10.1128/MCB.00046-18 PubMed 29891515