Skip to main content

pCIneoMyc UNC119Ab
(Plasmid #128332)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128332 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCIneo
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UNC119
  • Species
    H. sapiens (human)
  • GenBank ID
    9094
  • Entrez Gene
    UNC119 (a.k.a. HRG4, IMD13, POC7, POC7A)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer gataggcacctattggtcttactgacat
  • 3′ sequencing primer Gaacctgaaacataaaatgaat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCIneoMyc UNC119Ab was a gift from Yutaka Hata (Addgene plasmid # 128332 ; http://n2t.net/addgene:128332 ; RRID:Addgene_128332)
  • For your References section:

    UNC119 is a binding partner of tumor suppressor Ras-association domain family 6 and induces apoptosis and cell cycle arrest by MDM2 and p53. Iwasa H, Sarkar A, Shimizu T, Sawada T, Hossain S, Xu X, Maruyama J, Arimoto-Matsuzaki K, Withanage K, Nakagawa K, Kurihara H, Kuroyanagi H, Hata Y. Cancer Sci. 2018 Sep;109(9):2767-2780. doi: 10.1111/cas.13706. Epub 2018 Jul 28. 10.1111/cas.13706 PubMed 29931788