Skip to main content
Addgene

pQCXIP-mCherry-Halo-YAP1
(Plasmid #128336)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128336 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQCXIP
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YAP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1520
  • GenBank ID
    10413
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry and Halo-tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TACTTTCAGAGCGATAACGCG
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PCR was performed with the primers (H3244, 50-caattggcagaaatcggtactggctttccatc-30 and H3245, 50-acgcgtgaattccgcgttatcgctctgaaagta-30) on pHTN-Halo-tag vector (Promega) to amplify Halo-tag. The PCR product was digested with MfeI/MluI and ligated into EcoRI/MluI of pCIneomCherry to generate pCIneomCherry-Halo. MluI/NotI fragment from pCIneoFH-YAP1 was ligated into MluI/NotI sites of pCIneomCherry-Halo to generate pCIneomCherry-Halo-YAP1. NheI/NotI fragment from pCIneomCherry-Halo-YAP1 was ligated into XbaI/NotI of pQCXIP-EF to generate pQCXIP-mCherry-Halo-YAP1.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQCXIP-mCherry-Halo-YAP1 was a gift from Yutaka Hata (Addgene plasmid # 128336 ; http://n2t.net/addgene:128336 ; RRID:Addgene_128336)
  • For your References section:

    Novel YAP1 Activator, Identified by Transcription-Based Functional Screen, Limits Multiple Myeloma Growth. Maruyama J, Inami K, Michishita F, Jiang X, Iwasa H, Nakagawa K, Ishigami-Yuasa M, Kagechika H, Miyamura N, Hirayama J, Nishina H, Nogawa D, Yamamoto K, Hata Y. Mol Cancer Res. 2018 Feb;16(2):197-211. doi: 10.1158/1541-7786.MCR-17-0382. Epub 2017 Oct 23. 10.1158/1541-7786.MCR-17-0382 PubMed 29061667