Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFB-U6-control-gRNA-hSyn-mCherry-WPRE-SV40pA
(Plasmid #128347)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128347 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MLM3636
  • Backbone manufacturer
    Keith Joung (Addgene plasmid #43860)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    control (negative)
  • gRNA/shRNA sequence
    GCGAGGTATTCGGCTCCGCG
  • Species
    M. musculus (mouse)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB-U6-control-gRNA-hSyn-mCherry-WPRE-SV40pA was a gift from Ryan Drenan (Addgene plasmid # 128347 ; http://n2t.net/addgene:128347 ; RRID:Addgene_128347)
  • For your References section:

    Gene editing vectors for studying nicotinic acetylcholine receptors in cholinergic transmission. Peng C, Yan Y, Kim VJ, Engle SE, Berry JN, McIntosh JM, Neve RL, Drenan RM. Eur J Neurosci. 2018 May 19. doi: 10.1111/ejn.13957. 10.1111/ejn.13957 PubMed 29779223