pPHAGE-C20orf24- C20orf24-3’UTR-VAR
(Plasmid
#128509)
-
PurposeLentiviral constitutive expression of C20orf24 under control of its native 3'UTR of human C20orf24 with variant from COX deficiency patient.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPHAGE C-TAP
- Backbone size w/o insert (bp) 10056
- Total vector size (bp) 8758
-
Modifications to backboneAdded 3'UTR of C20orf24 with c.*398G>A (NM_018840.5) downstream from C20orf24 CDS
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAB5IF
-
SpeciesH. sapiens (human)
-
GenBank IDNM_018840.5
-
Entrez GeneRAB5IF (a.k.a. C20orf24, CFSMR2, OPTI, PNAS-11, RCAF1, RIP5)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG and HA tags (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGATACCCCTACGACGTG
- 3′ sequencing primer IRES-R CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a P136L mutation in C20orf24 compared to the NCBI reference squence NP_001186463.1. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPHAGE-C20orf24- C20orf24-3’UTR-VAR was a gift from Mohan Babu (Addgene plasmid # 128509 ; http://n2t.net/addgene:128509 ; RRID:Addgene_128509) -
For your References section:
Rewiring of the Human Mitochondrial Interactome during Neuronal Reprogramming Reveals Regulators of the Respirasome and Neurogenesis. Moutaoufik MT, Malty R, Amin S, Zhang Q, Phanse S, Gagarinova A, Zilocchi M, Hoell L, Minic Z, Gagarinova M, Aoki H, Stockwell J, Jessulat M, Goebels F, Broderick K, Scott NE, Vlasblom J, Musso G, Prasad B, Lamantea E, Garavaglia B, Rajput A, Murayama K, Okazaki Y, Foster LJ, Bader GD, Cayabyab FS, Babu M. iScience. 2019 Sep 4;19:1114-1132. doi: 10.1016/j.isci.2019.08.057. 10.1016/j.isci.2019.08.057 PubMed 31536960