Skip to main content

pPHAGE-C20orf24- C20orf24-3’UTR-VAR
(Plasmid #128509)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128509 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPHAGE C-TAP
  • Backbone size w/o insert (bp) 10056
  • Total vector size (bp) 8758
  • Modifications to backbone
    Added 3'UTR of C20orf24 with c.*398G>A (NM_018840.5) downstream from C20orf24 CDS
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RAB5IF
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_018840.5
  • Entrez Gene
    RAB5IF (a.k.a. C20orf24, CFSMR2, OPTI, PNAS-11, RCAF1, RIP5)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG and HA tags (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGGATACCCCTACGACGTG
  • 3′ sequencing primer IRES-R CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a P136L mutation in C20orf24 compared to the NCBI reference squence NP_001186463.1. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPHAGE-C20orf24- C20orf24-3’UTR-VAR was a gift from Mohan Babu (Addgene plasmid # 128509 ; http://n2t.net/addgene:128509 ; RRID:Addgene_128509)
  • For your References section:

    Rewiring of the Human Mitochondrial Interactome during Neuronal Reprogramming Reveals Regulators of the Respirasome and Neurogenesis. Moutaoufik MT, Malty R, Amin S, Zhang Q, Phanse S, Gagarinova A, Zilocchi M, Hoell L, Minic Z, Gagarinova M, Aoki H, Stockwell J, Jessulat M, Goebels F, Broderick K, Scott NE, Vlasblom J, Musso G, Prasad B, Lamantea E, Garavaglia B, Rajput A, Murayama K, Okazaki Y, Foster LJ, Bader GD, Cayabyab FS, Babu M. iScience. 2019 Sep 4;19:1114-1132. doi: 10.1016/j.isci.2019.08.057. 10.1016/j.isci.2019.08.057 PubMed 31536960