Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Rewiring of the Human Mitochondrial Interactome during Neuronal Reprogramming Reveals Regulators of the Respirasome and Neurogenesis.
Moutaoufik MT, Malty R, Amin S, Zhang Q, Phanse S, Gagarinova A, Zilocchi M, Hoell L, Minic Z, Gagarinova M, Aoki H, Stockwell J, Jessulat M, Goebels F, Broderick K, Scott NE, Vlasblom J, Musso G, Prasad B, Lamantea E, Garavaglia B, Rajput A, Murayama K, Okazaki Y, Foster LJ, Bader GD, Cayabyab FS, Babu M
iScience. 2019 Sep 4;19:1114-1132. doi: 10.1016/j.isci.2019.08.057. PubMed Article

Plasmids from Article

ID Plasmid Purpose
115178pENTR223-PARK7V51GGateway cloning of PARK7V51G into any destination vector
115179pENTR223-PARK7C53AGateway cloning of PARK7C53G into any destination vector
115180pENTR223-PARK7H126AGateway cloning of PARK7H126A into any destination vector
115181pENTR223-PARK7E163KGateway cloning of PARK7E163K into any destination vector
115182pLD-puro-Cc-PARK7WT-VALentiviral transduction and expression of PARK7WT into any mammalian cell
115183pLD-puro-Cc-PARK7V51G-VALentiviral transduction and expression of PARK7V51G into any mammalian cell
115184pLD-puro-Cc-PARK7C53A-VALentiviral transduction and expression of PARK7C53A into any mammalian cell
115185pLD-puro-Cc-PARK7H126A-VALentiviral transduction and expression of PARK7H126A into any mammalian cell
115186pLD-puro-Cc-PARK7E163K-VALentiviral transduction and expression of PARK7E163K into any mammalian cell
115187pLD-puro-Cc-CR-PARK7WT-VALentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)
115188pLD-puro-Cc-CR-PARK7V51G-VALentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)
115189pLD-puro-Cc-CR-PARK7C53A-VALentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)
115190pLD-puro-Cc-CR-PARK7H126A-VALentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)
115191pLD-puro-Cc-CR-PARK7E163K-VALentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)
115192pLEX307_PDHA2Lentiviral transduction and expression of PDHA2 into any mammalian cell
115196pLEX307_PDHA2S291ALentiviral transduction and expression of PDHA2S291A into any mammalian cell
115197pLEX307_PDHA2S293ALentiviral transduction and expression of PDHA2S293A into any mammalian cell
115198pLEX307_PDHA2S291A/S293ALentiviral transduction and expression of PDHA2S291A/S293A into any mammalian cell
115199pLEX307_CR-PDHA2Lentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')
115203pLEX307_CR-PDHA2S291ALentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')
115204pLEX307_CR-PDHA2S293ALentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')
115205pLEX307_CR-PDHA2S291A/S293ALentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')
128507pPHAGE-EF1α-Luc-C20orf24-3’UTR-VARLentiviral constitutive expression of Firefly luciferase under control of 3'UTR of human C20orf24 with variant from COX deficiency patient.
128508pPHAGE-C20orf24- C20orf24-3’UTR-WTLentiviral constitutive expression of C20orf24 under control of its native WT 3'UTR of human C20orf24.
128509pPHAGE-C20orf24- C20orf24-3’UTR-VARLentiviral constitutive expression of C20orf24 under control of its native 3'UTR of human C20orf24 with variant from COX deficiency patient.
128510pPHAGE-CR-PINK1-C-TAPLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.
128511pPHAGE-CR-NENF-C-TAPLentiviral constitutive expression of CRISPR-resistant NENF with c-terminal FLAG and HA tag.
128551pPHAGE-EF1α-Luc-C20orf24-3’UTR-WTLentiviral constitutive expression of Firefly luciferase under control of WT 3'UTR of human C20orf24.

Antibodies from Article