pPHAGE-CR-NENF-C-TAP
(Plasmid
#128511)
-
PurposeLentiviral constitutive expression of CRISPR-resistant NENF with c-terminal FLAG and HA tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128511 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPHAGE C-TAP
- Backbone size w/o insert (bp) 10056
- Total vector size (bp) 8360
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNENF
-
SpeciesH. sapiens (human)
-
MutationSynonymous silent mutations to F81, Y82, G83 and R85 to block sgRNA seed region binding
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG and HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AfeI (not destroyed)
- 3′ cloning site XcmI (not destroyed)
- 5′ sequencing primer ATCCACGCTGTTTTGACCTC
- 3′ sequencing primer AAGAAGCGGAGACGGTTAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPHAGE-CR-NENF-C-TAP was a gift from Mohan Babu (Addgene plasmid # 128511 ; http://n2t.net/addgene:128511 ; RRID:Addgene_128511) -
For your References section:
Rewiring of the Human Mitochondrial Interactome during Neuronal Reprogramming Reveals Regulators of the Respirasome and Neurogenesis. Moutaoufik MT, Malty R, Amin S, Zhang Q, Phanse S, Gagarinova A, Zilocchi M, Hoell L, Minic Z, Gagarinova M, Aoki H, Stockwell J, Jessulat M, Goebels F, Broderick K, Scott NE, Vlasblom J, Musso G, Prasad B, Lamantea E, Garavaglia B, Rajput A, Murayama K, Okazaki Y, Foster LJ, Bader GD, Cayabyab FS, Babu M. iScience. 2019 Sep 4;19:1114-1132. doi: 10.1016/j.isci.2019.08.057. 10.1016/j.isci.2019.08.057 PubMed 31536960