Skip to main content

pMJA065
(Plasmid #128517)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128517 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPIC9
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 8016
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ber e 1 a allergenic 2S albumin from Brazil nut
  • Alt name
    BRNALB2S2 or M80400
  • Species
    Bertholletia excelsa
  • Insert Size (bp)
    333
  • Promoter AOX1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
  • 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Secreted Ber e 1 major 2S albumin allergen from Brazil nut. Also reference PMID: 12911791.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJA065 was a gift from Marcos Alcocer (Addgene plasmid # 128517 ; http://n2t.net/addgene:128517 ; RRID:Addgene_128517)
  • For your References section:

    The disulphide mapping, folding and characterisation of recombinant Ber e 1, an allergenic protein, and SFA8, two sulphur-rich 2S plant albumins. Alcocer MJ, Murtagh GJ, Bailey K, Dumoulin M, Meseguer AS, Parker MJ, Archer DB. J Mol Biol. 2002 Nov 15;324(1):165-75. S0022283602010616 [pii] PubMed 12421566