pMJA105
(Plasmid
#128521)
-
PurposeExpresses amyloid human Lysozyme in Pichia pastoris
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPIC9
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 8005
-
Vector typeYeast Expression
-
Selectable markersHIS4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameArtificial gene for human lysozyme T70N
-
Alt nameLyz or X75362.1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)393
-
Entrez GeneLYZ (a.k.a. LYZF1, LZM)
- Promoter AOX1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvaI partial (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
- 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byLysozyme gene given by Prof Archer IFRN.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Secreted T70N amyloid Human mature lysozyme. Also reference PMID: 16441658.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA105 was a gift from Marcos Alcocer (Addgene plasmid # 128521 ; http://n2t.net/addgene:128521 ; RRID:Addgene_128521) -
For your References section:
Rationalising lysozyme amyloidosis: insights from the structure and solution dynamics of T70N lysozyme. Johnson RJ, Christodoulou J, Dumoulin M, Caddy GL, Alcocer MJ, Murtagh GJ, Kumita JR, Larsson G, Robinson CV, Archer DB, Luisi B, Dobson CM. J Mol Biol. 2005 Sep 30;352(4):823-36. doi: 10.1016/j.jmb.2005.07.040. 10.1016/j.jmb.2005.07.040 PubMed 16126226