Skip to main content

pMJA167
(Plasmid #128536)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128536 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUB6/V5-His A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5175
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NFAT-DsRed reporter
  • Alt name
    KX591058.1
  • Species
    Discosoma sp
  • Insert Size (bp)
    678
  • Promoter SV40-NFAT

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTTCACCGTCATCACCGAAACG
  • 3′ sequencing primer TGGGGATACCCCCTAGAGCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Report expression of DsRed in mammalian cells driven by NF-AT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJA167 was a gift from Marcos Alcocer (Addgene plasmid # 128536 ; http://n2t.net/addgene:128536 ; RRID:Addgene_128536)
  • For your References section:

    Optimisation and use of humanised RBL NF-AT-GFP and NF-AT-DsRed reporter cell lines suitable for high-throughput scale detection of allergic sensitisation in array format and identification of the ECM-integrin interaction as critical factor. Wang X, Cato P, Lin HC, Li T, Wan D, Alcocer MJ, Falcone FH. Mol Biotechnol. 2014 Feb;56(2):136-46. doi: 10.1007/s12033-013-9689-x. 10.1007/s12033-013-9689-x PubMed 23893250