pMJA167
(Plasmid
#128536)
-
PurposeExpresses DsRed
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUB6/V5-His A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5175
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNFAT-DsRed reporter
-
Alt nameKX591058.1
-
SpeciesDiscosoma sp
-
Insert Size (bp)678
- Promoter SV40-NFAT
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTTCACCGTCATCACCGAAACG
- 3′ sequencing primer TGGGGATACCCCCTAGAGCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Report expression of DsRed in mammalian cells driven by NF-AT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA167 was a gift from Marcos Alcocer (Addgene plasmid # 128536 ; http://n2t.net/addgene:128536 ; RRID:Addgene_128536) -
For your References section:
Optimisation and use of humanised RBL NF-AT-GFP and NF-AT-DsRed reporter cell lines suitable for high-throughput scale detection of allergic sensitisation in array format and identification of the ECM-integrin interaction as critical factor. Wang X, Cato P, Lin HC, Li T, Wan D, Alcocer MJ, Falcone FH. Mol Biotechnol. 2014 Feb;56(2):136-46. doi: 10.1007/s12033-013-9689-x. 10.1007/s12033-013-9689-x PubMed 23893250