pMJA181
(Plasmid
#128539)
-
PurposeExpresses anti-Prunus dulcis scFv Ab+BirA tag
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPICZalpha
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3526
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescFv Ab clone PD1F6 plus BirA tag
-
Alt nameLN889750.1
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)744
- Promoter AOX1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
- 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
secreted biotinylated scFv antibody anti Prunus dulcis in Pichia
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA181 was a gift from Marcos Alcocer (Addgene plasmid # 128539 ; http://n2t.net/addgene:128539 ; RRID:Addgene_128539) -
For your References section:
Production of in vivo biotinylated scFv specific to almond (Prunus dulcis) proteins by recombinant Pichia pastoris. de la Cruz S, Alcocer M, Madrid R, Garcia A, Martin R, Gonzalez I, Garcia T. J Biotechnol. 2016 Jun 10;227:112-9. doi: 10.1016/j.jbiotec.2016.04.024. Epub 2016 Apr 13. 10.1016/j.jbiotec.2016.04.024 PubMed 27085890