Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMJA181
(Plasmid #128539)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPICZalpha
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3526
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    scFv Ab clone PD1F6 plus BirA tag
  • Alt name
    LN889750.1
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    744
  • Promoter AOX1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
  • 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

secreted biotinylated scFv antibody anti Prunus dulcis in Pichia

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJA181 was a gift from Marcos Alcocer (Addgene plasmid # 128539 ; http://n2t.net/addgene:128539 ; RRID:Addgene_128539)
  • For your References section:

    Production of in vivo biotinylated scFv specific to almond (Prunus dulcis) proteins by recombinant Pichia pastoris. de la Cruz S, Alcocer M, Madrid R, Garcia A, Martin R, Gonzalez I, Garcia T. J Biotechnol. 2016 Jun 10;227:112-9. doi: 10.1016/j.jbiotec.2016.04.024. Epub 2016 Apr 13. 10.1016/j.jbiotec.2016.04.024 PubMed 27085890