-
PurposeExpresses nanobody-2H10 fused to Halo in mammalian cells. It recognizes gp41 peptide array (MoonTag peptide array).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128603 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNanobody_gp41
-
Alt nameNb-gp41
-
Alt nameNb_2H10
- Promoter SFFV
-
Tags
/ Fusion Proteins
- Halo
- GB1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTAACCAATCAGCCTGCTTC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Nb-gp41-Halo (MoonTag-Nb-Halo) was a gift from Marvin Tanenbaum (Addgene plasmid # 128603 ; http://n2t.net/addgene:128603 ; RRID:Addgene_128603) -
For your References section:
Multi-Color Single-Molecule Imaging Uncovers Extensive Heterogeneity in mRNA Decoding. Boersma S, Khuperkar D, Verhagen BMP, Sonneveld S, Grimm JB, Lavis LD, Tanenbaum ME. Cell. 2019 Jun 5. pii: S0092-8674(19)30499-4. doi: 10.1016/j.cell.2019.05.001. 10.1016/j.cell.2019.05.001 PubMed 31178119