pU6-sgRNA EF1Alpha-puro-T2A-BFP.DIS3L2-2
(Plasmid
#128763)
-
PurposeExpresses DIS3L2 gRNA for CRISPRi
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSICO derivative
- Backbone size w/o insert (bp) 8888
- Total vector size (bp) 8888
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDIS3L2 sgRNA #2
-
gRNA/shRNA sequenceGCCTCACCGTTTCTCCCCGG
-
SpeciesH. sapiens (human)
-
Entrez GeneDIS3L2 (a.k.a. FAM6A, PRLMNS, hDIS3L2)
- Promoter mU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site BlpI (not destroyed)
- 5′ sequencing primer mU6-F
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-sgRNA EF1Alpha-puro-T2A-BFP.DIS3L2-2 was a gift from David Bartel (Addgene plasmid # 128763 ; http://n2t.net/addgene:128763 ; RRID:Addgene_128763) -
For your References section:
A Network of Noncoding Regulatory RNAs Acts in the Mammalian Brain. Kleaveland B, Shi CY, Stefano J, Bartel DP. Cell. 2018 Jul 12;174(2):350-362.e17. doi: 10.1016/j.cell.2018.05.022. Epub 2018 Jun 7. 10.1016/j.cell.2018.05.022 PubMed 29887379