pX330-Utf1 gRNA
(Plasmid
#128842)
-
PurposegRNA for targeting mouse Utf1 locus using CRISPR-cas technique
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUtf1 gRNA
-
gRNA/shRNA sequenceCACCGCCATCCCCATCTCAAACCT
-
SpeciesM. musculus (mouse)
-
Entrez GeneUtf1 (a.k.a. AI505934)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-Utf1 gRNA was a gift from Yossi Buganim (Addgene plasmid # 128842 ; http://n2t.net/addgene:128842 ; RRID:Addgene_128842) -
For your References section:
Direct Induction of the Three Pre-implantation Blastocyst Cell Types from Fibroblasts. Benchetrit H, Jaber M, Zayat V, Sebban S, Pushett A, Makedonski K, Zakheim Z, Radwan A, Maoz N, Lasry R, Renous N, Inbar M, Ram O, Kaplan T, Buganim Y. Cell Stem Cell. 2019 Jun 6;24(6):983-994.e7. doi: 10.1016/j.stem.2019.03.018. Epub 2019 Apr 25. 10.1016/j.stem.2019.03.018 PubMed 31031139