Skip to main content

pT7-L1T1L-NLuc
(Plasmid #128942)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128942 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p3E5
  • Backbone size w/o insert (bp) 3073
  • Total vector size (bp) 7614
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    L1 minor core protein
  • Alt name
    lambda-3 protein
  • Species
    Mammalian orthoreovirus 1
  • Insert Size (bp)
    4541
  • GenBank ID
  • Promoter T7 promotor
  • Tag / Fusion Protein
    • Nanoluc

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAAGAGCGCCCAATACGCAAAC
  • 3′ sequencing primer CTTTGTTAGCAGCCGGATCCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-L1T1L-NLuc was a gift from Takeshi Kobayashi (Addgene plasmid # 128942 ; http://n2t.net/addgene:128942 ; RRID:Addgene_128942)
  • For your References section:

    In vivo live imaging of oncolytic mammalian orthoreovirus expressing NanoLuc luciferase in tumor xenograft mice. Kanai Y, Kawagishi T, Matsuura Y, Kobayashi T. J Virol. 2019 May 8. pii: JVI.00401-19. doi: 10.1128/JVI.00401-19. 10.1128/JVI.00401-19 PubMed 31068423