pORTMAGE312B
(Plasmid
#128969)
-
PurposeBroad-host-range KanR plasmid expressing PapRecT and EcMutL_E32K with Toluic acid induction
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSEVA258
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 9839
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePapRecT
-
SpeciesP. aeruginosa
-
Insert Size (bp)747
-
GenBank IDWP_003088368
- Promoter xylS-Pm
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GATAAGTCCAGCCTTGCAAG
- 3′ sequencing primer CACTAGTTCTTTGACTACCGACG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemutL E32K
-
Alt nameDominant-Negative MutL
-
SpeciesE. coli
-
Insert Size (bp)1848
-
MutationE32K
-
GenBank IDNP_418591
- Promoter xylS-Pm
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GATAAGTCCAGCCTTGCAAG
- 3′ sequencing primer GTTCTGAACAAATCCAGATG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pORTMAGE312B was a gift from George Church (Addgene plasmid # 128969 ; http://n2t.net/addgene:128969 ; RRID:Addgene_128969) -
For your References section:
Improved bacterial recombineering by parallelized protein discovery. Wannier TM, Nyerges A, Kuchwara HM, Czikkely M, Balogh D, Filsinger GT, Borders NC, Gregg CJ, Lajoie MJ, Rios X, Pal C, Church GM. Proc Natl Acad Sci U S A. 2020 Jun 16;117(24):13689-13698. doi: 10.1073/pnas.2001588117. Epub 2020 May 28. 10.1073/pnas.2001588117 PubMed 32467157