Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGEX2T-GATA3
(Plasmid #1290)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 1290 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-2T
  • Backbone manufacturer
    Amersham Biosciences
  • Backbone size w/o insert (bp) 4900
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GATA3
  • Alt name
    GATA-3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2000
  • GenBank ID
    NM_008091
  • Entrez Gene
    Gata3 (a.k.a. Gata-3, jal)
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX2T-GATA3 was a gift from Gokhan Hotamisligil (Addgene plasmid # 1290 ; http://n2t.net/addgene:1290 ; RRID:Addgene_1290)
  • For your References section:

    Function of GATA transcription factors in preadipocyte-adipocyte transition. Tong Q, Dalgin G, Xu H, Ting CN, Leiden JM, Hotamisligil GS. Science 2000 Oct 6;290(5489):134-8. 10.1126/science.290.5489.134 PubMed 11021798