pGEX2T-GATA3
(Plasmid
#1290)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 1290 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-2T
-
Backbone manufacturerAmersham Biosciences
- Backbone size w/o insert (bp) 4900
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGATA3
-
Alt nameGATA-3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2000
-
GenBank IDNM_008091
-
Entrez GeneGata3 (a.k.a. Gata-3, jal)
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX2T-GATA3 was a gift from Gokhan Hotamisligil (Addgene plasmid # 1290 ; http://n2t.net/addgene:1290 ; RRID:Addgene_1290) -
For your References section:
Function of GATA transcription factors in preadipocyte-adipocyte transition. Tong Q, Dalgin G, Xu H, Ting CN, Leiden JM, Hotamisligil GS. Science 2000 Oct 6;290(5489):134-8. 10.1126/science.290.5489.134 PubMed 11021798