XR1_pHCLYBL-CAG-LSL-GFP-P2A-RFP
(Plasmid
#129111)
-
PurposeHomologous recombination vector for excision reporter 1 in the CLYBL locus.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneunknown
- Total vector size (bp) 12595
-
Vector typeMammalian Expression, Cre/Lox, TALEN
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLSL, eGFP, NLS-RFP
-
SpeciesH. sapiens (human)
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gcaacgtgctggttattgtg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byChong Park
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XR1_pHCLYBL-CAG-LSL-GFP-P2A-RFP was a gift from Bruce Conklin (Addgene plasmid # 129111 ; http://n2t.net/addgene:129111 ; RRID:Addgene_129111)