pY71-PT7-RiboJ-sfGFP-MGapt
(Plasmid
#129119)
-
PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.
-
Depositing Lab
-
Depositing OrganizationU.S. Army Combat Capabilities Development Command, Chemical Biological Center (DEVCOM CBC)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepY71
- Backbone size w/o insert (bp) 1641
- Total vector size (bp) 2583
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperfolder GFP with Malachite Green aptamer
-
Alt namesfGFP
-
Alt nameMG aptamer: ACAATAACTGAATAGGGATCCCGACTGGCGAGAGCCAGGTAACGAATGGATCC
-
SpeciesSynthetic
-
Insert Size (bp)942
- Promoter T7
-
Tags
/ Fusion Proteins
- His6 (N terminal on insert)
- RiboJ Insulator (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7
- 3′ sequencing primer T7 Terminator
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pY71-PT7-RiboJ-sfGFP-MGapt was a gift from Matthew Lux (Addgene plasmid # 129119 ; http://n2t.net/addgene:129119 ; RRID:Addgene_129119) -
For your References section:
Quantification of Interlaboratory Cell-Free Protein Synthesis Variability. Cole SD, Beabout K, Turner KB, Smith ZK, Funk VL, Harbaugh SV, Liem AT, Roth PA, Geier BA, Emanuel PA, Walper SA, Chavez JL, Lux MW. ACS Synth Biol. 2019 Sep 20;8(9):2080-2091. doi: 10.1021/acssynbio.9b00178. Epub 2019 Sep 10. 10.1021/acssynbio.9b00178 PubMed 31386355