Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #129237)


Item Catalog # Description Quantity Price (USD)
Plasmid 129237 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Modifications to backbone
    Contains N-terminal 8xHis, fusion partner: Lipo (Lipoyl-binding domain of Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex from Geobacillus stearothermophilus, UniProtKB: P11961) followed by TEV protease cleavage site, optional C-terminal StrepII-tag. Cloning of GOI between BsaI and XhoI or HindIII.
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tags / Fusion Proteins
    • Strep (C terminal on backbone)
    • His (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pOP_up: TACGACTCACTATAGGGAATTGTGAGC
  • 3′ sequencing primer pOP_dn: GCAGCCAACTCAGCTTCCTTTCG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pExp-Lipo was a gift from Marko Hyvönen (Addgene plasmid # 129237 ; ; RRID:Addgene_129237)