pLenti-mCherry-CAAX
(Plasmid
#129285)
-
PurposeLentiviral plasmid for expression of fluorescent reporter mCherry targeted to the plasma membrane via CAAX polybasic sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129285 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLV 1-5
- Backbone size w/o insert (bp) 6374
- Total vector size (bp) 7217
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFluorescent reporter mCherry fused to CAAX polybasic sequence
-
Insert Size (bp)843
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- CAAX (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACAGTGCAGGGGAAAGAATAGT
- 3′ sequencing primer ATTGTCAGTGCCCAACAGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-mCherry-CAAX was a gift from Carlos Carmona-Fontaine (Addgene plasmid # 129285 ; http://n2t.net/addgene:129285 ; RRID:Addgene_129285) -
For your References section:
The MEMIC is an ex vivo system to model the complexity of the tumor microenvironment. Janska L, Anandi L, Kirchberger NC, Marinkovic ZS, Schachtner LT, Guzelsoy G, Carmona-Fontaine C. Dis Model Mech. 2021 Aug 1;14(8). pii: 271783. doi: 10.1242/dmm.048942. Epub 2021 Aug 18. 10.1242/dmm.048942 PubMed 34407185