CMV-Tagger
(Plasmid
#129396)
-
PurposeExpresses 2A-separated rpl22, UPRT, mKate2 and Ago2 driven by CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129396 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2
- Total vector size (bp) 9106
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerpl22-HA-2A-UPRT-mKate2-FLAG-V5-Ago2
-
Alt nameTagger
-
SpeciesH. sapiens (human), M. musculus (mouse); Toxoplasma gondii
-
Insert Size (bp)5034
- Promoter CMV
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- FLAG (N terminal on insert)
- V5 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MfeI (not destroyed)
- 3′ cloning site MfeI (not destroyed)
- 5′ sequencing primer GGTAGGCGTGCCTAATGG
- 3′ sequencing primer GTGGTTTGTCCAAACTCATCAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-Tagger was a gift from Walker Jackson (Addgene plasmid # 129396 ; http://n2t.net/addgene:129396 ; RRID:Addgene_129396) -
For your References section:
Tagger-A Swiss army knife for multiomics to dissect cell type-specific mechanisms of gene expression in mice. Kaczmarczyk L, Bansal V, Rajput A, Rahman RU, Krzyzak W, Degen J, Poll S, Fuhrmann M, Bonn S, Jackson WS. PLoS Biol. 2019 Aug 8;17(8):e3000374. doi: 10.1371/journal.pbio.3000374. eCollection 2019 Aug. 10.1371/journal.pbio.3000374 PubMed 31393866