Skip to main content

CMV-Tagger
(Plasmid #129396)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129396 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2
  • Total vector size (bp) 9106
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rpl22-HA-2A-UPRT-mKate2-FLAG-V5-Ago2
  • Alt name
    Tagger
  • Species
    H. sapiens (human), M. musculus (mouse); Toxoplasma gondii
  • Insert Size (bp)
    5034
  • Promoter CMV
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • FLAG (N terminal on insert)
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MfeI (not destroyed)
  • 3′ cloning site MfeI (not destroyed)
  • 5′ sequencing primer GGTAGGCGTGCCTAATGG
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-Tagger was a gift from Walker Jackson (Addgene plasmid # 129396 ; http://n2t.net/addgene:129396 ; RRID:Addgene_129396)
  • For your References section:

    Tagger-A Swiss army knife for multiomics to dissect cell type-specific mechanisms of gene expression in mice. Kaczmarczyk L, Bansal V, Rajput A, Rahman RU, Krzyzak W, Degen J, Poll S, Fuhrmann M, Bonn S, Jackson WS. PLoS Biol. 2019 Aug 8;17(8):e3000374. doi: 10.1371/journal.pbio.3000374. eCollection 2019 Aug. 10.1371/journal.pbio.3000374 PubMed 31393866