CMV-Tagger
(Plasmid #129396)

• Purpose: Expresses 2A-separated rpl22, UPRT, mKate2 and Ago2 driven by CMV promoter
• Depositing Lab: Walker Jackson
• Publication: Kaczmarczyk et al PLoS Biol. 2019 Aug 8;17(8):e3000374. doi: 10.1371/journal.pbio.3000374. eCollection 2019 Aug.

Backbone

• Vector backbone: pCS2
• Total vector size (bp): 9106
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rpl22-HA-2A-UPRT-mKate2-FLAG-V5-Ago2
• Alt name: Tagger
• Species: H. sapiens (human), M. musculus (mouse); Toxoplasma gondii
• Insert Size (bp): 5034
• Promoter: CMV
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • FLAG (N terminal on insert)
  • V5 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MfeI (not destroyed)
• 3′ cloning site: MfeI (not destroyed)
• 5′ sequencing primer: GGTAGGCGTGCCTAATGG
• 3′ sequencing primer: GTGGTTTGTCCAAACTCATCAA

Resource Information

• Supplemental Documents:
  • CMV-Tagger.str
  • ORF

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry