MADR pDonor TagBFP2-3XFlag (cyto) WPRE
(Plasmid
#129421)
-
PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of a TagBFP2-3XFlag cytoplasmic reporter protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129421 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMADR pDonor
-
Backbone manufacturerBreunig lab
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 5910
-
Vector typeMosaic analysis for dual recombinase-mediated cassette exchange (MADR) donor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagBFP2-3Flag
-
SpeciesEntacmaea quadricolor
-
Insert Size (bp)774
- Promoter none (3X polyA to mitigate episomal expression)
-
Tag
/ Fusion Protein
- 3X Flag epitope tag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer MADR-MCS-F (TCGACCTGCAGCCCAAGCTA)
- 3′ sequencing primer WPRE-R (Addgene) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutated TagBFP to TagBFP2 (I174A substitution)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MADR pDonor TagBFP2-3XFlag (cyto) WPRE was a gift from Joshua Breunig (Addgene plasmid # 129421 ; http://n2t.net/addgene:129421 ; RRID:Addgene_129421) -
For your References section:
Rapid Generation of Somatic Mouse Mosaics with Locus-Specific, Stably Integrated Transgenic Elements. Kim GB, Rincon Fernandez Pacheco D, Saxon D, Yang A, Sabet S, Dutra-Clarke M, Levy R, Watkins A, Park H, Abbasi Akhtar A, Linesch PW, Kobritz N, Chandra SS, Grausam K, Ayala-Sarmiento A, Molina J, Sedivakova K, Hoang K, Tsyporin J, Gareau DS, Filbin MG, Bannykh S, Santiskulvong C, Wang Y, Tang J, Suva ML, Chen B, Danielpour M, Breunig JJ. Cell. 2019 Sep 19;179(1):251-267.e24. doi: 10.1016/j.cell.2019.08.013. 10.1016/j.cell.2019.08.013 PubMed 31539496