Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MADR pDonor-H3F3A-K27M-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
(Plasmid #131462)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131462 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MADR pDonor
  • Backbone manufacturer
    Breunig Lab
  • Total vector size (bp) 10906
  • Vector type
    Mammalian Expression, Cre/Lox, Synthetic Biology ; Mosaic analysis for dual recombinase-mediated cassette exchange (MADR) donor

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H3F3A-K27M-EGFP AU1 pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Mutation
    H3F3A K27M, Pdgfra D842V
  • Promoter none (4x polyA to mitigate episomal expression)
  • Tag / Fusion Protein
    • Trp53-V5, H3F3A-EGFP-AU1

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer MADR-MCSF (TCGACCTGCAGCCCAAGCTA)
  • 3′ sequencing primer WPRE-R (addgene)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MADR pDonor-H3F3A-K27M-EGFP pTV1 Pdgfra D842V COTv1 Trp53-V5 WPRE was a gift from Joshua Breunig (Addgene plasmid # 131462 ; http://n2t.net/addgene:131462 ; RRID:Addgene_131462)
  • For your References section:

    Rapid Generation of Somatic Mouse Mosaics with Locus-Specific, Stably Integrated Transgenic Elements. Kim GB, Rincon Fernandez Pacheco D, Saxon D, Yang A, Sabet S, Dutra-Clarke M, Levy R, Watkins A, Park H, Abbasi Akhtar A, Linesch PW, Kobritz N, Chandra SS, Grausam K, Ayala-Sarmiento A, Molina J, Sedivakova K, Hoang K, Tsyporin J, Gareau DS, Filbin MG, Bannykh S, Santiskulvong C, Wang Y, Tang J, Suva ML, Chen B, Danielpour M, Breunig JJ. Cell. 2019 Sep 19;179(1):251-267.e24. doi: 10.1016/j.cell.2019.08.013. 10.1016/j.cell.2019.08.013 PubMed 31539496