pFB1_hPMS2
(Plasmid #129425)

• Purpose: Expression human PMS2 protein using baculovirus
• Depositing Lab: Peggy Hsieh
• Publication: Geng et al Anal Biochem. 2011 Jun 15;413(2):179-84. doi: 10.1016/j.ab.2011.02.017. Epub 2011 Feb 15.

Backbone

• Vector backbone: pFastBac 1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4776
• Total vector size (bp): 7333
• Modifications to backbone: hPMS2 is inserted in MCS (5'- BamH 1 and 3'- Sal I) of pFastBac 1. 5' sequencing primer covers nucleotides from 112-142 of hPMS2, but antiparallel, 3' sequencing primer covers nucleotides from 2456-2490 of hPMS2. They are used to sequence junction of the insert. The plasmid is used to amplify and generate recombinant bacmid DNA. which will then be transfected into insect cells for virus generation and eventually for protein (hPMS2) expression.
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use DH10Bac for bacmid expression.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human PMS2
• Alt name: DNA mismatch repair protein homolog (PMS2)
• Species: H. sapiens (human)
• Insert Size (bp): 2589
• GenBank ID: U14658
• Entrez Gene: PMS2 (a.k.a. HNPCC4, LYNCH4, MLH4, MMRCS4, PMS-2, PMS2CL, PMSL2)
• Promoter: Polyhedrin promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH I (not destroyed)
• 3′ cloning site: Sal I (not destroyed)
• 5′ sequencing primer: ccagactgttttctactaactcctttaccgc
• 3′ sequencing primer: ggactgctctcaacacaagcgagatgaagaaactg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry