pBN449
(Plasmid
#129555)
-
PurposeGAL4-induced expression of codon-optimised FLP recombinase with unfused mNeongreen (mNG) as a marker in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBN412
- Total vector size (bp) 11121
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name15xUAS-∆pes-10-Flp-SL2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2442
- Promoter UAS-∆pes-10
-
Tag
/ Fusion Protein
- mNeonGreen
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (destroyed during cloning)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer gctctgcgagaaatagtacagca
- 3′ sequencing primer TCGACGAATTGACGGACGAGGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPaul Sternberg lab (CalTech)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
15xUAS sequence from pHW394 inserted into pBN412
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBN449 was a gift from Peter Askjaer (Addgene plasmid # 129555 ; http://n2t.net/addgene:129555 ; RRID:Addgene_129555) -
For your References section:
Spatiotemporal control of genome recombination through combined FLP-Frt and GAL4-UAS technologies. Ayuso C, Askjaer P. MicroPubl Biol. 2019 Jan 29;2019:10.17912/micropub.biology.000089. doi: 10.17912/micropub.biology.000089. 10.17912/micropub.biology.000089 PubMed 32550473