p231-pOsAct1::hpt-pZmUbi::BdPetC-p35S::mTurquoise
(Plasmid
#129650)
-
PurposeRieske FeS overexpression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAGM4723
- Total vector size (bp) 12560
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDS of PetC gene encoding for the Rieske FeS subunit
-
SpeciesBrachypodium distachyon
-
Insert Size (bp)663
-
MutationCodon modified for Golden Gate
-
GenBank IDBRADI_1g24980v3
- Promoter pZmUbi
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TATTTCCACCATGGGTTCTCGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p231-pOsAct1::hpt-pZmUbi::BdPetC-p35S::mTurquoise was a gift from Susanne von Caemmerer (Addgene plasmid # 129650 ; http://n2t.net/addgene:129650 ; RRID:Addgene_129650) -
For your References section:
Overexpression of the Rieske FeS protein of the Cytochrome b 6 f complex increases C4 photosynthesis in Setaria viridis. Ermakova M, Lopez-Calcagno PE, Raines CA, Furbank RT, von Caemmerer S. Commun Biol. 2019 Aug 16;2:314. doi: 10.1038/s42003-019-0561-9. eCollection 2019. 10.1038/s42003-019-0561-9 PubMed 31453378