-
PurposeExpressing SpCas9 and sgAAVS1-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3-basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 8548
-
Modifications to backboneOnly plasmid backbone for amplification in E.coli was used.
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9 and sgAAVS1-1
-
gRNA/shRNA sequenceACCCCACAGTGGGGCCACTA ggg
-
SpeciesH. sapiens (human)
- Promoter hU6
-
Tag
/ Fusion Protein
- P2A-Puro (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer gactatcatatgcttaccgt
- 3′ sequencing primer - (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9-sgAAVS1-1 was a gift from Elina Ikonen (Addgene plasmid # 129726 ; http://n2t.net/addgene:129726 ; RRID:Addgene_129726) -
For your References section:
An efficient auxin-inducible degron system with low basal degradation in human cells. Li S, Prasanna X, Salo VT, Vattulainen I, Ikonen E. Nat Methods. 2019 Aug 26. pii: 10.1038/s41592-019-0512-x. doi: 10.1038/s41592-019-0512-x. 10.1038/s41592-019-0512-x PubMed 31451765