pCZGY1584 Pcol-19::ebp-2::mGFP::unc-54 3'UTR
(Plasmid
#129774)
-
PurposeMarker of microtubule dynamics in C. elegans hypodermis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129774 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDEST
-
Backbone manufacturerInvitrogen Gateway
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 5985
-
Vector typeWorm Expression, Synthetic Biology ; Gateway
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePcol-19
-
Alt namecol-19p
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)665
- Promoter Pcol-19
-
Tag
/ Fusion Protein
- Synthetic Intron (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer CAGGAAACAGCTATGACCATG
- 3′ sequencing primer ttgatgaactgatgtctttc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameebp-2
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1100
-
GenBank IDCELE_VW02B12L.3
-
Entrez Geneebp-2 (a.k.a. CELE_VW02B12L.3)
-
Tag
/ Fusion Protein
- mGFP (C terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer CCAAAGGACCCAAAGGTATG
- 3′ sequencing primer CTGAACTTGTGGCCGTTTAC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameunc-54 3'UTR
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)735
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer TCGGCATGGACGAGCTGTAC
- 3′ sequencing primer TGCCGCATAGTTAAGCCAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMade by Suhong Xu in the Chisholm Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: The plasmid region containing col-19 promoter and 5' synthetic intron are in the opposite orientation in the plasmid compared to the depositor's sequence. This is not known to be a concern for plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY1584 Pcol-19::ebp-2::mGFP::unc-54 3'UTR was a gift from Andrew Chisholm (Addgene plasmid # 129774 ; http://n2t.net/addgene:129774 ; RRID:Addgene_129774) -
For your References section:
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair. Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD. Elife. 2016 Sep 23;5. doi: 10.7554/eLife.15833. 10.7554/eLife.15833 PubMed 27661253