pAAV_COL4A5_self-cleavingCas9
(Plasmid
#130282)
-
PurposeExpresses an spCas9 under the control of a CMV promoter; The spCas9 is flanked by COL4A5 sgRNA targets to induce its self-cleaving and inactivation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130282 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV2.1
- Backbone size w/o insert (bp) 3889
- Total vector size (bp) 8239
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9
-
Insert Size (bp)4350
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer cgtggatagcggtttgactc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_COL4A5_self-cleavingCas9 was a gift from Silvestro Conticello (Addgene plasmid # 130282 ; http://n2t.net/addgene:130282 ; RRID:Addgene_130282) -
For your References section:
New frontiers to cure Alport syndrome: COL4A3 and COL4A5 gene editing in podocyte-lineage cells. Daga S, Donati F, Capitani K, Croci S, Tita R, Giliberti A, Valentino F, Benetti E, Fallerini C, Niccheri F, Baldassarri M, Mencarelli MA, Frullanti E, Furini S, Conticello SG, Renieri A, Pinto AM. Eur J Hum Genet. 2019 Nov 21. pii: 10.1038/s41431-019-0537-8. doi: 10.1038/s41431-019-0537-8. 10.1038/s41431-019-0537-8 PubMed 31754267