Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV_COL4A5_self-cleavingCas9
(Plasmid #130282)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130282 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV2.1
  • Backbone size w/o insert (bp) 3889
  • Total vector size (bp) 8239
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spCas9
  • Insert Size (bp)
    4350
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer cgtggatagcggtttgactc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_COL4A5_self-cleavingCas9 was a gift from Silvestro Conticello (Addgene plasmid # 130282 ; http://n2t.net/addgene:130282 ; RRID:Addgene_130282)
  • For your References section:

    New frontiers to cure Alport syndrome: COL4A3 and COL4A5 gene editing in podocyte-lineage cells. Daga S, Donati F, Capitani K, Croci S, Tita R, Giliberti A, Valentino F, Benetti E, Fallerini C, Niccheri F, Baldassarri M, Mencarelli MA, Frullanti E, Furini S, Conticello SG, Renieri A, Pinto AM. Eur J Hum Genet. 2019 Nov 21. pii: 10.1038/s41431-019-0537-8. doi: 10.1038/s41431-019-0537-8. 10.1038/s41431-019-0537-8 PubMed 31754267